After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat ENG Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENGcDNA Clone Product Information
cDNA Size:1953
cDNA Description:ORF Clone of Rattus norvegicus endoglin DNA.
Gene Synonym:MGC124909, Eng
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.