Quick Order

Text Size:AAA

Mouse NRN1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse NRN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_153529.2
RefSeq ORF Size:429bp
cDNA Description:Full length Clone DNA of Mus musculus neuritin 1 with C terminal HA tag.
Gene Synonym:Nrn, Cpg15, 0710008J23Rik
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Neuritin 1 (NRN1) is a member of neuritin family. Neuritin is a glycosylphosphatidylinositol- anchored protein induced by neural activity. It is expressed in postmitotic-differentiating neurons of the developing nervous system and a population of small-diameter neurons in the dorsal root ganglia and was anterogradely and retrogradely transported. Neuritin message is induced by neuronal activity and by the activity-regulated neurotrophins BDNF, nerve growth factor (NGF) and NT-3. Purified recombinant neuritin promotes neurite outgrowth and arborization in primary embryonic hippocampal and cortical cultures. Thus, neuritin is considered as a downstream effector of activity-induced neurite outgrowth. In clinical, neuritin levels in diabetes were reduced in both dorsal root ganglia and sciatic nerve of rats, and these deficits were reversed in vivo by treatment with NGF. This manipulation of neuritin levels in diabetes may provide a potential target for the therapeutic intervention in the management of neuropathy.

References
  • Karamoysoyli E, et al. (2008) Neuritin mediates nerve growth factor-induced axonal regeneration and is deficient in experimental diabetic neuropathy. Diabetes. 57(1): 181-9.
  • Naeve GS, et al. (1997) Neuritin: A gene induced by neural activity and neurotrophins that promotes neuritogenesis. Proc Natl Acad Sci U S A. 94(6): 2648-2653.
  • Kojima N, et al. (2005) Expression of neuritin during liver maturation and regeneration. FEBS Lett. 579(21): 4562-6.
  • Size / Price
    Catalog: MG52152-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"