Quick Order

Text Size:AAA

Mouse FAM3D Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FAM3DcDNA Clone Product Information
cDNA Size:672
cDNA Description:ORF Clone of Mus musculus oncoprotein induced transcript 1 DNA.
Gene Synonym:EF-7, Fam3d, AV067083, MGC37550, 2310076N21Rik, Oit1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Family with sequence similarity 3 (FAM3) family is a novel cytokine-like gene family, which has four genes in this family, FAM3A, FAM3B, FAM3C, and FAM3D, each encoding a protein (224-235 amino acids) with a hydrophobic leader sequence. It had indicated that FAM3B/PANDER (pancreatic derived factor) is highly expressed in pancreas, and FAM3A and FAM3C in almost all tissues. FAM3D is abundantly expressed in placenta and weakly expressed in small intestine. Immunohistochemistry showed that FAM3A is expressed prominently in the vascular endothelium, particularly capillaries. FAM3A and FAM3B protein were both localized to the islets of Langerhans of the endocrine pancreas. Recombinant FAM3B protein has delayed effects on beta-cell function. FAM3C is involved in retinal laminar formation processes in vertebrates. NFATC2, SCP2, CACNA1C, TCRA, POLE, and FAM3D, were associated with narcolepsy. Some of these associations were further supported by gene expression analyses and an association study in essential hypersomnia (EHS), CNS hypersonia similar to narcolepsy.

  • Zhu Y, et al. (2002) Cloning, expression, and initial characterization of a novel cytokine-like gene family. Genomics. 80(2): 144-50.
  • Katahira T, et al. (2010) Secreted factor FAM3C (ILEI) is involved in retinal laminar formation. Biochem Biophys Res Commun. 392(3): 301-6.
  • Shimada M, et al. (2010) An approach based on a genome-wide association study reveals candidate loci for narcolepsy. Hum Genet. 128(4): 433-41.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items