Quick Order

Mouse CLEC4D Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4DcDNA Clone Product Information
Gene_bank_ref_id:NM_010819.3
cDNA Size:660
cDNA Description:ORF Clone of Mus musculus C-type lectin domain family 4, member d DNA.
Gene Synonym:mcl, Mpcl, Clecsf8, MGC117678, Clec4d
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

C-type lectin (CLEC) family is a type of carbohydrate-binding protein domain named lectin. C-type lectins are the most diverse and prevalent lectin family in immunity with its requirement for calcium for binding. Proteins including a C-type lectin domain have diverse range of functions including cell-cell adhesion, immune response to pathogens and apoptosis. There are at least 14 types of C-type lectins: typeⅠto typeⅩⅣ. CLEC4D(CLECSF8) is a typeⅡ membrane glycoprotein belonging to the C-type lectin family, with restricted expression in the monocyte/macrophage lineage. It plays important roles in the function of macrophages.

References
  • Johnson KD, et al. (2007) Friend of GATA-1-independent Transcriptional Repression: A Novel Mode of GATA-1 Function. Blood. 109 (12): 5230-3.
  • Arce I, et al. (2004) The human C-type lectin CLECSF8 is a novel monocyte/macrophage endocytic receptor. Eur J Immunol. 34 (1): 210-20.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36 (8): 2159-69.
  • Size / Price
    Catalog:MG50946-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"