After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse TIMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TIMP2cDNA Clone Product Information
Gene_bank_ref_id:NM_011594.3
cDNA Size:663
cDNA Description:ORF Clone of Mus musculus tissue inhibitor of metalloproteinase 2 DNA.
Gene Synonym:Timp-2, D11Bwg1104e, Timp2
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Tissue inhibitors of metalloproteinases (TIMP) family are natural inhibitors of the matrix metalloproteinases (MMPs), the zinc enzymes involved in extracellular matrix maintenance and remodeling. The TIMP family encompasses four members (TIMP1-4), and they inhibit most MMPs by forming non-covalent binary complex. TIMP2 is a 22 kDa non N-glycosylated protein expressed by a variety of cell types, and plays a unique role among TIMP family members owing to its functions to regulate cellular responses to growth factors. Findings establish an unexpected, MMP-independent mechanism for TIMP2 inhibition of endothelial cell proliferation in vitro and reveal an important component of the antiangiogenic effect of TIMP2 in vivo. TIMP-2 thus is critical to the maintenance of tissue homeostasis and is involved in the regulation of tumor microenvironment.

References
  • Stetler-Stevenson, W.G. et al., 1992, Matrix. Suppl.1: 299-306.
  • Stetler-Stevenson, W.G. et al., 2005, Trends. Mol. Med. 11: 97-103.
  • Seo, D.W. et al., 2003, Cell. 114: 171-180.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"