Quick Order

Mouse METAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
METAP1DcDNA Clone Product Information
cDNA Size:1008
cDNA Description:ORF Clone of Mus musculus methionyl aminopeptidase type 1D (mitochondrial) DNA.
Gene Synonym:Map1d, Metapl1, AV117938, 2310066F24Rik, 3110033D18Rik, Metap1d
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse METAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

Methionine aminopeptidase 1D, also known as MAP1D, is a member of the peptidase M24A family. N-terminal methionine removal is an important cellular process required for proper biological activity, subcellular localization, and eventual degradation of many proteins. The enzymes that catalyze this reaction are called Methionine aminopeptidases (MAPs). MAP1D is overexpressed in colon cancer cell lines and colon tumors as compared to normal tissues (at protein level). Downregulation of MAP1D expression by shRNA in HCT-116 colon carcinoma cells reduces anchorage-independant growth in soft agar. MAP1D binds two cobalt ions per subunit. The true nature of the physiological cofactor is under debate. MAP1D is also active with zinc, manganese or divalent ions. MAP1D removes the amino-terminal methionine from nascent proteins. It may also play an important role in colon tumorigenesis.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks