After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat VEGFB ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat VEGFB cDNA Clone Product Information
Gene_bank_ref_id:NM_053549.1
RefSeq ORF Size:561bp
cDNA Description:Full length Clone DNA of Rattus norvegicus vascular endothelial growth factor B with N terminal His tag.
Gene Synonym:Vegfb
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Human VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGF-B / VEGFB Protein (Fc Tag)Mouse VEGFA / VEGF164 ProteinHuman VEGF121 / VEGF-A ProteinMouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Mouse PIGF / PLGF Protein (Fc Tag)Rat VEGF164 / VEGFA ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGF121 / VEGF-A ProteinMouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinDanio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinMouse VEGF-D / VEGFD / FIGF Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Mouse PIGF / PLGF ProteinHuman VEGF121b / VEGF-A ProteinCanine VEGF / VEGFA ProteinHuman Neuropilin 2 / NRP2 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein
Size / Price
Catalog: RG80114-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"