Quick Order

Mouse SMYD3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SMYD3 cDNA Clone Product Information
Gene_bank_ref_id:NM_027188.3
RefSeq ORF Size:1287bp
cDNA Description:Full length Clone DNA of Mus musculus SET and MYND domain containing 3 with N terminal HA tag.
Gene Synonym:Zmynd1, 2410008A19Rik, Smyd3
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

References
  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Size / Price
    Catalog: MG50930-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"