Quick Order

Mouse TACSTD2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TACSTD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_020047.3
RefSeq ORF Size:954bp
cDNA Description:Full length Clone DNA of Mus musculus tumor-associated calcium signal transducer 2 with N terminal HA tag.
Gene Synonym:Ly97, EGP-1, TROP2, C80403, GA733-1, MGC141612, MGC141613, Tacstd2
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TROP-2, also referred to as tumor associated calcium signal transducer 2 (TACSTD2), GA733-1 or M1S1, is a cell surface glycoprotein highly expressed in a wide variety of epithelial cancers. In contrast, there is little or no expression of Trop-2 in adult somatic tissue. Because it is a cell surface protein that is selectively expressed in tumor cells, Trop-2 is a potential therapeutic target. The cytoplasmic tail of Trop-2 possesses potential serine and tyrosine phosphorylation sites and a phosphatidyl-inositol binding consensus sequence. Trop-2 transduces an intracellular calcium signal, are consistent with the hypothesis that it acts as a cell surface receptor and support a search for a physiological ligand. TROP2 encoding by an intronless gene was originally defined by the monoclonal antibody GA733, and is a member of a family of at least two type I membrane proteins. The other known member is GA733-2, also called EpCAM and TROP1. It has been suggested by studies that the GA733-1 gene was formed by the retroposition of the GA733-2 gene via an mRNA intermediate.

References
  • Ripani E, et al. (1998) Human Trop-2 is a tumor-associated calcium signal transducer. Int J Cancer. 76(5): 671-6.
  • Wang J, et al. (2008) Identification of Trop-2 as an oncogene and an attractive therapeutic target in colon cancers. Mol Cancer Ther. 7(2): 280-5.
  • Size / Price
    Catalog: MG50922-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"