Quick Order

Text Size:AAA

Mouse Cystatin-E / CST6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST6cDNA Clone Product Information
cDNA Size:450
cDNA Description:ORF Clone of Mus musculus cystatin E/M DNA.
Gene Synonym:ichq, N28197, 1110017E11Rik, Cst6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the cystatin superfamily, and inhibits papain and cathepsin B. Cystatin E is a low molecular mass secreted protein existing in both a glycosylated (17 kDa) and an unglycosylated (14 kDa) form, with two characteristic intrachain disulfide bridges. Expression of cystatin M/E is found to be restricted to the epidermis, more specifically in the stratum granulosum, sweat glands, sebaceous glands, and the hair follicles. In addition to its function as a cysteine protease inhibitor, cystatin M/E also serves as a target for cross-linking by transglutaminases. Accordingly, cystatin M/E was suggested to be involved in barrier formation and maintenance. Furthermore, studies have revealed that cystatin M/E is frequently epigenetically inactivated during breast carcinogenesis, and thus be regarded as a candidate of tumour suppressor gene.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items