Quick Order

Text Size:AAA

Mouse PDGFD Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
PDGFDcDNA Clone Product Information
Gene Bank Ref.ID:NM_027924.2
cDNA Size:1113
cDNA Description:ORF Clone of Mus musculus platelet-derived growth factor, D polypeptide DNA.
Gene Synonym:1110003I09Rik, Pdgfd
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Platelet-derived growth factor D (PDGF-D), also known as Iris-expressed growth factor, is a member of the PDGF/vascular endothelial growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. PDGF-D/PDGFD only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. The expression of PDGF-D/PDGFD in the eye is tissue-specific. In the anterior segment, it is localized to iris and ciliary body, whereas in the retina, PDGF-D/PDGFD is restricted to the outer plexiform layer. PDGF-D/PDGFD is present in aqueous humor but is not detectable in mature lens or in mouse lens-derived alphaTN4-1 cells. PDGF-D/PDGFD is highly expressed in human breast cancer and facilitates tumor growth and lymph node metastasis, making it a potential target in breast cancer. PDGF-D/PDGFD increases drug delivery and hence improves the efficacy of chemotherapy through vessel normalization. Intervention in the PDGF-D pathway in the eye, perhaps by antibody or blocking peptide, could be useful in the treatment of certain cataracts, including post-operative secondary cataract.

  • Ray S, et al. (2005) Platelet-derived growth factor D, tissue-specific expression in the eye, and a key role in control of lens epithelial cell proliferation. J Biol Chem. 280(9): 8494-502.
  • Uutela M, et al. (2004) PDGF-D induces macrophage recruitment, increased interstitial pressure, and blood vessel maturation during angiogenesis. Blood. 104 (10): 3198-204.
  • Taneda S, et al. (2004) Obstructive uropathy in mice and humans: potential role for PDGF-D in the progression of tubulointerstitial injury. J Am Soc Nephrol. 14 (10): 2544-55.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks