After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse DDOST Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
DDOSTcDNA Clone Product Information
Gene Bank Ref.ID:NM_007838.2
cDNA Size:1326
cDNA Description:ORF Clone of Mus musculus dolichyl-di-phosphooligosaccharide-protein glycotransferase DNA.
Gene Synonym:Ddost
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

The enzyme oligosaccharyltransferase (dolichyl-diphosphooligosaccharide-protein glycosyltransferase) (DDOST), or 48-kDa subunit (OST48) is one of the catalytic subunits in this complex, exerts a typical type I membrane topology, containing a large luminal domain, a hydrophobic transmembrane domain and a short cytosolic peptide tail. DDOST/OST48 catalyzes the transfer of a high-mannose oligosaccharide (GlcNac2Man9Glc3) from a dolichol-linked oligosaccharide donor (dolichol-P-GlcNac2Man9Glc3) onto the asparagine acceptor site within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains across the membrane of the endoplasmic reticulum. The mammalian oligosaccharyltransferase (OST) is an oligomeric complex composed of three type I transmembrane proteins of the endoplasmic reticulum: ribophorin I (RI), ribophorin II (RII), and OST48. OST48 is not a glycoprotein and is not recognized by antibodies to either ribophorin. Like ribophorins I and II, OST48 was found to be an integral membrane protein, with the majority of the polypeptide located within the lumen of the endoplasmic reticulum (ER). OST48 does not show significant amino acid sequence homology to either ribophorin I or II. It had been found that only the luminal domain of RI contains ER retention information. The dilysine motif in OST48 functions as an ER localization motif because OST48 in which the two lysine residues are replaced by serine (OST48ss) is no longer retained in the ER and is found instead also at the plasma membrane.

  • Silberstein S, et al. (1992) The 48-kDa subunit of the mammalian oligosaccharyltransferase complex is homologous to the essential yeast protein WBP1. J Biol Chem. 267(33): 23658-63.
  • Fu J, et al. (1997) Interactions among subunits of the oligosaccharyltransferase complex. J Biol Chem. 272(47): 29687-92.
  • Yamagata T, et al. (1997) Genomics. Genome organization of human 48-kDa oligosaccharyltransferase (DDOST). 45(3): 535-40.
  • Fu J, et al. (2000) Retention of subunits of the oligosaccharyltransferase complex in the endoplasmic reticulum. J Biol Chem. 275(6): 3984-90.
  • Hardt B, et al. (2001) Analysis of structural signals conferring localisation of pig OST48 to the endoplasmic reticulum. Biol Chem. 382(7): 1039-47.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks