Quick Order

Text Size:AAA

Mouse CCDC47 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CCDC47 cDNA Clone Product Information
Gene_bank_ref_id:NM_026009.2
RefSeq ORF Size:1452bp
cDNA Description:Full length Clone DNA of Mus musculus coiled-coil domain containing 47 with C terminal HA tag.
Gene Synonym:asp4, C88307, calumin, 2610204L23Rik, RP23-81G14.10
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CCDC47 gene is expressed at high level. The gene contains 16 distinct gt-ag introns. Transcription produces 9 different mRNAs, 6 alternatively spliced variants and 3 unspliced forms. There are 3 probable alternative promotors, 3 non overlapping alternative last exons and 8 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of a cassette exon, overlapping exons with different boundaries. Functionally, CCDC47 gene has been proposed to participate in processes such as calcium ion homeostasis, embryo development, ER overload response and post-embryonic development. CCDC47 are expected to have molecular function (calcium ion binding) and to localize in various compartments (membrane, endoplasmic reticulum, integral to membrane, microsome).

References
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog: MG52105-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"