After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat PRLR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRLRcDNA Clone Product Information
cDNA Size:1833
cDNA Description:ORF Clone of Rattus norvegicus prolactin receptor DNA.
Gene Synonym:RATPRLR, MGC105486, Prlr
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Prolactin receptor (PRLR) is a single-pass transmembrane receptor belonging to the type â…  cytokine receptor superfamily, and contains two fibronectin type-â…¢ domains. All class 1 ligands activate their respective receptors by clustering mechanisms. Ligand binding results in the transmembrane PRLR dimerization, followed by phosphorylation and activation of the molecules invloved in the signaling pathways, such as Jak-STAT, Ras/Raf/MAPK. The PRLR contains no intrinsic tyrosine kinase cytoplasmic domain but associates with a cytoplasmic tyrosine kinase, JAK2. PRLR mainly serves as the receptor for the pituitary hormone prolactin (PRL), a secreted hormone that affects reproduction and homeostasis in vertebrates. PRLR can be regulated by an interplay of two different mechanisms, PRL or ovarian steroid hormones independently or in combination in a tissue-specific manner. The role of the hormone prolactin (PRL) in the pathogenesis of breast cancer is mediated by its cognate receptor (PRLR). Ubiquitin-dependent degradation of the PRLR that negatively regulates PRL signaling is triggered by PRL-mediated phosphorylation of PRLR on Ser349 followed by the recruitment of the beta-transducin repeats-containing protein (beta-TrCP) ubiquitin-protein isopeptide ligase. which altered PRLR stability may directly influence the pathogenesis of breast cancer.

  • Bole-Feysot C, et al. (1998) Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev. 19(3): 225-68.
  • Goffin V, et al. (1999) From the molecular biology of prolactin and its receptor to the lessons learned from knockout mice models. Genet Anal. 15(3-5): 189-201.
  • Li Y, et al. (2006) Stabilization of prolactin receptor in breast cancer cells. Oncogene. 25(13): 1896-902.
  • Shao R, et al. (2008) Differences in prolactin receptor (PRLR) in mouse and human fallopian tubes: evidence for multiple regulatory mechanisms controlling PRLR isoform expression in mice. Biol Reprod. 79(4): 748-57.