After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat APCS / SAP Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
APCScDNA Clone Product Information
cDNA Size:687
cDNA Description:ORF Clone of Rattus norvegicus amyloid P component, serum DNA.
Gene Synonym:Sap, Apcs
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.

  • Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.
  • Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.
  • Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.
  • de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items