After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PDK / PDZ binding kinase / TOPK ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PBK cDNA Clone Product Information
Gene_bank_ref_id:NM_023209.2
RefSeq ORF Size:993bp
cDNA Description:Full length Clone DNA of Mus musculus PDZ binding kinase with N terminal HA tag.
Gene Synonym:TOPK, AW538537, D14Ertd732e, 2810434B10Rik, Pbk
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PDZ binding kinase (PBK), also known as TOPK (T-LAK cell-originated protein kinase), is a serine/threonine kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family, and has all the characteristic protein kinase subdomains and a C-terminal PDZ-binding T/SXV motif. PBK is expressed in the testis restrictedly expressed in outer cell layer of seminiferous tubules, as well as placenta. PBK may be enrolled in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis.This mitotic kinase phosphorylates MAP kinase p38 and seems to be active in mitosis. When phosphorylated, PBK forms a protein-protein interaction with tumor suppressor p53 (TP53), leading to TP53 destabilization and attenuation of G2/M checkpoint during doxorubicin-induced DNA damage. The expression level of PBK is thus upregulated in a variety of neoplasms including hematological malignancies.

Size / Price
Catalog: MG50887-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"