After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat GDNF ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat GDNF cDNA Clone Product Information
Gene_bank_ref_id:NM_019139.1
RefSeq ORF Size:636bp
cDNA Description:Full length Clone DNA of Rattus norvegicus glial cell derived neurotrophic factor with N terminal His tag.
Gene Synonym:Gdnf
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Background

Glial cell line-derived neurotrophic factor(GDNF) is an important member of the GDNF family of ligands(GFL). The GDNF family of ligands is comprised by four neurotrophic factors: glial cell line-derived neurotrophic factor (GDNF), neurturin (NRTN), artemin (ARTN), and persephin (PSPN). It has been found that GFLs play a role in a number of biological processes including cell survival, neurite outgrowth, cell differentiation and cell migration. As the founding member, GDNF plays a key role in the promotion of the survival of dopaminergic neurons. GDNF is a highly conserved neurotrophic factor. The recombinant form of this protein also promotes the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. GDNF also regulates kidney development and spermatogenesis, and it affects alcohol consumption. It has been shown that GDNF results in two Parkinson's disease clinical trial and in a number of animal trials. It has been taken as a potent survival factor for central motoneurons.

References
  • Oppenheim RW, et al. (1995) Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF. Nature. 373 (6512): 344-6.
  • Tomac A, et al. (1995) Protection and repair of the nigrostriatal dopaminergic system by GDNF in vivo. Nature. 373 (6512): 335-9.
  • Schindelhauer D, et al. (1996) The gene coding for glial cell line derived neurotrophic factor (GDNF) maps to chromosome 5p12-p13.1. Genomics. 28 (3): 605-7.
  • Carnicella S, et al. (2008) GDNF is a fast-acting potent inhibitor of alcohol consumption and relapse. Proc Natl Acad Sci . 105 (23): 8114-9.
  • Size / Price
    Catalog: RG80050-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"