Quick Order

Rat CXCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL1cDNA Clone Product Information
cDNA Size:291
cDNA Description:ORF Clone of Rattus norvegicus chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) DNA.
Gene Synonym:Gro1, CINC-1, Cxcl1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Chemokine & Receptor Related Products
Product nameProduct name

The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GRO?, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-a). CXCL1 already known to be important in osteoarthritis (OA), as a novel target gene of transcription factor AP-2? in chondrocytes and support the important role of AP-2? in cartilage. CXCL1 is a potent neutrophil chemoattractant with recognized roles in angiogenesis and inflammation. CXCL1 is a novel immediate PTH/PTHrP-responsive gene. CXCL1 may act as a chemoattractant for osteoclast precursors. CXCL1 may also have important pro-nociceptive effects via its direct actions on sensory neurons, and may induce long-term changes that involve protein synthesis. CXCL1 plays a critical nonredundant role in the development of experimental Lyme arthritis and carditis via CXCR2-mediated recruitment of neutrophils into the site of infection. CXCL1 functions through CXCR2 to transactivate the EGFR by proteolytic cleavage of HB-EGF, leading to activation of MAPK signalling and increased proliferation of epithelial ovarian cancer (EOC) cells. It might limit tumor growth by reinforcing senescence early in tumorigenesis. Thus, CXCL1 plays a role in spinal cord development by inhibiting the migration of oligodendrocyte precursors and is involved in the processes of angiogenesis, inflammation, wound healing, and tumorigenesis.

  • Wang JG, et al. (2008) The chemokine CXCL1/growth related oncogene increases sodium currents and neuronal excitability in small diameter sensory neurons. Mol Pain. 4: 38.
  • Acosta JC, et al. (2009) A role for CXCR2 in senescence, but what about in cancer? Cancer Res. 69(6): 2167-70.
  • Onan D, et al. (2009) The chemokine Cxcl1 is a novel target gene of parathyroid hormone (PTH)/PTH-related protein in committed osteoblasts. Endocrinology. 150(5): 2244-53.
  • Ritzman AM, et al. (2010) The chemokine receptor CXCR2 ligand KC (CXCL1) mediates neutrophil recruitment and is critical for development of experimental Lyme arthritis and carditis. Infect Immun. 78(11): 4593-600.
  • Bolitho C, et al. (2010) The chemokine CXCL1 induces proliferation in epithelial ovarian cancer cells by transactivation of the epidermal growth factor receptor. Endocr Relat Cancer. 17(4): 929-40.
  • Wenke AK, et al. (2011) The transcription factor AP-2? regulates CXCL1 during cartilage development and in osteoarthritis. Osteoarthritis Cartilage. 19(2): 206-12.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items