Quick Order

Rat FTH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FTH1cDNA Clone Product Information
cDNA Size:549
cDNA Description:ORF Clone of Rattus norvegicus ferritin, heavy polypeptide 1 DNA.
Gene Synonym:Fth
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

FTH1 (ferritin, heavy polypeptide 1) is the heavy subunit of ferritin which is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. FTH1 gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. FTH1 stores iron in a soluble, non-toxic, readily available form. It is important for iron homeostasis. It has ferroxidase activity. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. It also plays a role in delivery of iron to cells. FTH1 mediates iron uptake in capsule cells of the developing kidney.

  • Hentze MW, et al. (1986) Cloning, characterization, expression, and chromosomal localization of a human ferritin heavy-chain gene. Proc Natl Acad Sci. 83(19):7226-30.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Stelzl, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-968.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks