Quick Order

Text Size:AAA

Mouse JTB Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
JTBcDNA Clone Product Information
cDNA Size:441
cDNA Description:ORF Clone of Mus musculus jumping translocation breakpoint DNA.
Gene Synonym:Gm622
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items