After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SPG21 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SPG21cDNA Clone Product Information
cDNA Size:927
cDNA Description:ORF Clone of Mus musculus spastic paraplegia 21 homolog (human) DNA.
Gene Synonym:MAST, ACP33, GL010, BM-019, C78576, D9Wsu18e, Spg21
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Spastic paraplegia 21 (SPG21), also known as acid Cluster Protein 33 (ACP33) and Mast syndrome protein, is a member of the AB hydrolase superfamily. Human SPG21 is a 308 amino acid residue protein widely expressed in all tissues, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation via the noncatalytic alpha/beta hydrolase fold domain. SPG21 thus is proposed to play a role as a negative regulatory factor in CD4-dependent T-cell activation of CD4. Defects in SPG21 are the cause of spastic paraplegia autosomal recessive type 21, also known as Mast syndrome, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. SPG21 is also associated with dementia and other central nervous system abnormalities.

  • Zeitlmann L. et al., 2001, J Biol Chem. 276: 9123-32.
  • Simpson M. A. et al., 2003, Am J Hum Genet. 73: 1147-156.
  • Ota T. et al., 2004, Nat. Genet.36: 40-45.
  • Kedmi M. et al., 2007, Physiol Genomics. 28: 213-22.
  • Hanna M. C. et al., 2009, Neurogenetics.10: 217-28.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks