After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD93 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD93 cDNA Clone Product Information
Gene_bank_ref_id:NM_010740.3
RefSeq ORF Size:1935bp
cDNA Description:Full length Clone DNA of Mus musculus CD93 antigen with N terminal HA tag.
Gene Synonym:Ly68, AA4.1, C1qr1, C1qrp, AA145088, AW555904, 6030404G09Rik, Cd93
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CD93 or C1q receptor 1 (C1qR) is an about 120 kDa O-sialoglycoprotein that within the hematopoietic system is selectively expressed on cells of the myeloid lineage. CD93/C1qR is a highly glycosylated transmembrane protein expressed on monocytes, neutrophils, endothelial cells, and stem cells. CD93 was originally identified as a myeloid cell-surface marker and subsequently associated with an ability to modulate phagocytosis of suboptimally opsonized immunoglobulin G and complement particles in vitro. CD93/C1qR, a receptor expressed during early B-cell development, is reinduced during plasma-cell differentiation. High CD93/CD138 expression was restricted to antibody-secreting cells both in T-dependent and T-independent responses as naive, memory, and germinal-center B cells remained CD93-negative. CD93 was expressed on (pre)plasmablasts/plasma cells, including long-lived plasma cells that showed decreased cell cycle activity, high levels of isotype-switched Ig secretion, and modification of the transcriptional network. CD93 is important for the maintenance of plasma cells in bone marrow niches.

References
  • Bohlson SS, et al. (2005) CD93 is rapidly shed from the surface of human myeloid cells and the soluble form is detected in human plasma. J Immunol. 175(2): 1239-47.
  • Norsworthy PJ, et al. (2004) Murine CD93 (C1qRp) contributes to the removal of apoptotic cells in vivo but is not required for C1q-mediated enhancement of phagocytosis. J Immunol. 172(6): 3406-14.
  • Chevrier S, et al. (2009) CD93 is required for maintenance of antibody secretion and persistence of plasma cells in the bone marrow niche. Proc Natl Acad Sci U S A. 106(10): 3895-900.
  • Size / Price
    Catalog: MG50759-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"