Quick Order

Text Size:AAA

Mouse SMPD1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SMPD1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011421.2
RefSeq ORF Size:1884bp
cDNA Description:Full length Clone DNA of Mus musculus sphingomyelin phosphodiesterase 1, acid lysosomal with N terminal HA tag.
Gene Synonym:ASM, aSMase, A-SMase, Zn-SMase, Smpd1
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Sphingomyelin phosphodiesterase 1 (SMPD1) , also known as ASM ( acid sphingomyelinase ), is a member of the acid sphingomyelinase family of enzymes. Three isoforms have been identified, isoform 1 is 631 amino acids (aa) in length as the pro form, while Isoform 2 and isoform 3 have lost catalytic activity. The active SMPD1 isoform 1 contains one saposin B-type domain that likely interacts with sphingomyelin, and a catalytic region. Human SMPD1 is 86% aa identical to mouse SMPD1. SMPD1 is a monomeric lysosomal enzyme that converts sphingomyelin (a plasma membrane lipid ) into ceramide through the removal of phosphorylcholine. This generates second messenger components that participate in signal transduction. Defects in SMPD1 are the cause of Niemann-Pick disease type A (NPA) and type B (NPB), also known as Niemann-Pick disease classical infantile form and Niemann-Pick disease visceral form. Niemann-Pick disease is a clinically and genetically heterogeneous recessive disorder. NPB has little if any neurologic involvement and patients may survive into adulthood.

Size / Price
Catalog: MG50749-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"