Quick Order

Mouse TFRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TFRCcDNA Clone Product Information
Gene_bank_ref_id:NM_011638.4
cDNA Size:2292
cDNA Description:ORF Clone of Mus musculus transferrin receptor DNA.
Gene Synonym:TR, TFR, p90, CD71, TFR1, Trfr, Mtvr1, Mtvr-1, AI195355, AI426448, AU015758, 2610028K12Rik, E430033M20Rik, Tfrc
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Mouse transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

References
  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • Size / Price
    Catalog:MG50741-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"