Quick Order

Text Size:AAA

Mouse ST6GAL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ST6GAL1cDNA Clone Product Information
Gene_bank_ref_id:NM_145933.3
cDNA Size:1212
cDNA Description:ORF Clone of Mus musculus beta galactoside alpha 2,6 sialyltransferase 1 DNA.
Gene Synonym:Siat1, St6gal, St6galI, AW742324, MGC116663, St6gal1
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Beta-galactoside alpha-2,6-sialyltransferase 1, also known as B-cell antigen CD75, Sialyltransferase 1, CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase 1, ST6GAL1 and SIAT1, is a single-pass type II membrane protein which belongs to the glycosyltransferase 29 family. Sialyltransferases are key enzymes in the biosynthesis of sialoglycoconjugates that catalyze the transfer of sialic residue from its activated form to an oligosaccharidic acceptor. ST6GAL1 / SIAT1 is normally found in the?Golgi?but which can be proteolytically processed to a soluble form. It is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CDw75, and CD76. β-Galactoside α2,6-sialyltransferases ST6GAL1 and ST6GAL2 are the two unique members of the ST6GAL family described in higher vertebrates. ST6GAL1 / SIAT1 transfers sialic acid from the donor of substrate CMP-sialic acid to galactose containing acceptor substrates.

References
  • Collins,B.E. et al., 2006, Nat Immunol. 7(2):199-206.
  • Videira,P.A. et al., 2008, Glycoconj J. 25(3): 259-68.
  • Petit,D. et al., 2010, J Biol Chem. 285(49): 38399-414.
  • Kroes,R.A. et al., 2010, Proc Natl Acad Sci USA.107(28):12646-51.
  • Size / Price
    Catalog:MG50740-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"