Quick Order

Mouse SELP Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SELPcDNA Clone Product Information
cDNA Size:2307
cDNA Description:ORF Clone of Mus musculus selectin, platelet DNA.
Gene Synonym:Grmp, CD62P, PADGEM, MGC129336, MGC129337, P-selectin, Selp
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

P selectin (SELP) is a 140kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. SELP mediates rapid rolling of leukocyte rolling over vascular surfaces during the initial steps in inflammation through interaction with PSGL1. P selectin is a cell adhesion molecule on the surface of activated endothelial cells. Cellular adhesion molecules are a large family of proteins that attach the cytoskeleton and intracellular signaling cascades with the extracellular environment. SELP is a calcium-dependent receptor for myeloid cells that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interacton of activated endothelial cells or platelets with leukocytes.

  • Johnson-Tidey RR, et al. (1994) Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1. Am J Pathol. 144(5):952-61.
  • Walcheck B, et al. (1996) Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1. A mechanism that amplifies initial leukocyte accumulation of P-selectin in vitro. J Clin Invest. 98(5):1081-7.
  • Foreman KE, et al. (1994) C5a-induced expression of P-selectin in endothelial cells. J Clin Invest. 94(3):1147-55.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items