Quick Order

Mouse GABARAPL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GABARAPL1cDNA Clone Product Information
Gene_bank_ref_id:NM_020590.4
cDNA Size:354
cDNA Description:ORF Clone of Mus musculus gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 DNA.
Gene Synonym:GECI, Apg8l, Atg8l, AI196471, MNCb-0091, 3110025G09Rik, 9130422N19Rik
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse GABARAPL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name
Background

ATG8, also known as GABARAPL1, is a ubiquitin-like protein which has a crystal structure. ATG8 consists of a 5-stranded β-sheet, which is enclosed by two α-helices at one side and one α-helix at the other side and exhibits a conserved GABARAP domain. It functions in the formation of autophagosomal membranes. The transient conjugation of ATG8 to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Autophagy is induced upon nutrient depletion or rapamycin treatment and leads to the response of more than 30 autophagy-related (ATG) genes known so far, including ATG8.

References
  • Ohsumi Y, et al. (2004) The crystal structure of microtubule-associated protein light chain 3, a mammalian homologue of Saccharomyces cerevisiae Atg8. Genes Cells. 9(7):611-8.
  • Geng J, et al. (2008) The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep. 9(9):859-644.
  • Suzuki NN, et al. (2005) The crystal structure of plant ATG12 and its biological implication in autophagy. Autophagy. 1(2):119-126.
  • Size / Price
    Catalog:MG52711-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"