Quick Order

Text Size:AAA

Mouse AARSD1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AARSD1cDNA Clone Product Information
cDNA Size:1239
cDNA Description:ORF Clone of Mus musculus alanyl-tRNA synthetase domain containing 1 DNA.
Gene Synonym:AlaX, AA589600, AlaXp-II, 1110069E20Rik, 2310044P18Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

AARSD1 belongs to the class-II aminoacyl-tRNA synthetase family, Alax-L subfamily. AARSD1 binds 1 zinc ion per subunit functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). Four transcript variants have been described for AARSD1: NM_025267.3, NM_001136042.2, NM_001142653.1 and NM_001142654.1. It has been determined that the latter two variants represent a distinct upstream locus, which is now represented by GeneID:100885848 (PTGES3L), while the former two variants represent readthrough transcripts between PTGES3L and this locus (AARSD1). The readthrough locus (PTGES3L-AARSD1) is now represented by GeneID:100885850.

  • Tatham MH, et al. (2011) Comparative proteomic analysis identifies a role for SUMO in protein quality control. Oncogene. 19(17):2120-8.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items