After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PTK6 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PTK6 cDNA Clone Product Information
Gene_bank_ref_id:NM_009184.2
RefSeq ORF Size:1353bp
cDNA Description:Full length Clone DNA of Mus musculus PTK6 protein tyrosine kinase 6 with N terminal HA tag.
Gene Synonym:BRK, Sik, tks, Tksk, Ptk6
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Tyrosine kinase (PTKs) is a protein that carry out tyrosine phosphorylation, which play a fundamental role in cell proliferation, survival, adhesion, and motility and have also been demenstrated to mediate malignant cell transformation. Overexpression of this protein in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Two classes of PTKs are present in cells: the transmembrane receptor PTKs and the non-receptor PTKs. Tyrosine kinase(PTKs)-6/ BRK is a cytoplasmic non-receptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Tyrosine kinase(PTKs)-6/ BRK has been shown to undergo autophosphorylation. It has been found that the constitutive expression of the tyrosine kinase(PTKs)-6/ BRK is in a large proportion of cutaneous T-cell lymphomas and other transformed T- and B-cell populations. State BRK expression was also induced in normal T-cells. In clinical, the cytoplasmic tyrosine kinase PTK6 (BRK) shows elevated expression in approximately two-thirds of primary breast tumours, and is implicated in EGF receptor-dependent signalling and epithelial tumorigenesis.

References
  • Aubele M, et al. (2008) Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of breast cancer patients.British Journal of Cancer. 99: 1089-95.
  • Kasprzycka M, et al. (2006) Expression and oncogenic role of Brk (PTK6/sik) protein tyrosine kinase in lymphocytes. American Journal of Pathology. 168: 1631-41.
  • Hubbard SR, et al. (2000) Protein tyrosine kinase structure and function. Annual review of biochemistry. 69: 373-98.
  • Size / Price
    Catalog: MG50710-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"