Quick Order

Mouse CD302 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD302cDNA Clone Product Information
Gene_bank_ref_id:NM_025422.3
cDNA Size:660
cDNA Description:ORF Clone of Mus musculus CD302 antigen DNA.
Gene Synonym:AI159627, 1110055L24Rik, Cd302
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

CD302/CLEC13A (C-type lectin domain family 13 member A), also known as C-type lectin receptor DCL-1, is a type I transmembrane C-type lectin DCL-1/CD302. DCL-1 protein was highly conserved among the human, mouse, and rat orthologs. DCL-1 ectodomain contains only one CRD, whereas other type I transmembrane C-type lectins contain more than one domain (e.g. selectins and MMR). DCL-1 CP contains several putative motifs, including a Tyr-based internalization, a cluster of acidic amino acids, and Ser and Tyr phosphorylation motifs, suggesting that DCL-1 CP mediates not only endocytosis and late endosome targeting but also signaling. DCL-1 may be another cell/matrix adhesion receptor integrated in cell adhesion complexes and that DCL-1 dysfunction may affect APC adhesion and migration, causing suppression of APC function.

References
  • Kato M, et al. (2007) The novel endocytic and phagocytic C-Type lectin receptor DCL-1/CD302 on macrophages is colocalized with F-actin, suggesting a role in cell adhesion and migration. J Immunol. 179(9): 6052-63.
  • Skinnider BF, et al. (2002) The role of cytokines in classical Hodgkin lymphoma. Blood. 99(12): 4283-97.
  • Size / Price
    Catalog:MG50706-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"