Quick Order

Rat CRIP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CRIP2cDNA Clone Product Information
Gene_bank_ref_id:NM_022501.1
cDNA Size:627
cDNA Description:ORF Clone of Rattus norvegicus cysteine-rich protein 2 DNA.
Gene Synonym:CRP2
Species:Rat
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

CRIP2 is a putative transcription factor. It has a widespread tissue expression and is highly expressed in heart. CRIP2 contains two LIM zinc-binding domains. CRIP2 may participate in the differentiation of smooth muscle tissue. It also plays an important role in esophageal squamous cell carcinoma (ESCC) tumorigenesis. CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis. It interacts with the NF-κB/p65 to inhibit its DNA-binding ability to the promoter regions of the major proangiogenesis cytokines critical for tumor progression, including IL6, IL8, and VEGF. In conclusion, we provide compelling evidence that CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis.

References
  • Chang DF. et al., 2003, Dev Cell. 4 (1):107-18.
  • Huber A. et al., 2000, J Biol Chem. 275 (8): 5504-11.
  • Karim MA. et al., 1996, Genomics. 31 (2): 167-76.
  • Size / Price
    Catalog:RG81186-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"