Quick Order

Mouse ILKAP ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ILKAP cDNA Clone Product Information
Gene_bank_ref_id:NM_023343.2
RefSeq ORF Size:1179bp
cDNA Description:Full length Clone DNA of Mus musculus integrin-linked kinase-associated serine/threonine phosphatase 2C with N terminal His tag.
Gene Synonym:PP2C-DELTA, 0710007A14Rik, 1600009O09Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Integrin-linked kinase-associated serine/threonine phosphatase 2C, also known as ILKAP, is cytoplasm protein which belongs to the PP2C family. ILKAP contains one PP2C-like domain. ILKAP is widely expressed. Highest levels expressed in striated muscle. Much lower levels evident in various smooth muscle tissues. ILKAP may play a role in regulation of cell cycle progression via dephosphorylation of its substrates whose appropriate phosphorylation states might be crucial for cell proliferation. ILKAP selectively associates with integrin linked kinase (ILK), to modulate cell adhesion and growth factor signaling. ILKAP inhibits the ILK-GSK3B signaling axis and may play an important role in inhibiting oncogenic transformation. Integrin-linked kinase ( ILK ) plays key roles in a variety of cell functions, including cell proliferation, adhesion and migration. Within the cell, ILK localizes to multiple sites, including the cytoplasm, focal adhesion complexes that mediate cell adhesion to extracellular substrates, as well as cell-cell junctions in epidermal keratinocytes. Nuclear ILK can be rapidly exported into the cytoplasm through a CRM1-dependent pathway, and its export is enhanced by the type 2C protein phosphatase ILKAP. Nuclear localization of ILK in epidermal keratinocytes is associated with increased DNA synthesis, which is sensitive to inhibition by ILKAP.

References
  • Leung-Hagesteijn C. et al., 2001, EMBO J. 20: 2160-70.
  • Kumar,A.S. et al., 2004, Oncogene. 23 (19):3454-61.
  • Lammers,T. et al., 2007, Crit Rev Biochem Mol Biol. 42 (6):437-61.
  • Nakrieko,K.A. et al., 2008, Cell Cycle. 7 (14):2157-66.
  • Size / Price
    Catalog: MG52651-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"