Quick Order

Text Size:AAA

Mouse PRDX2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRDX2cDNA Clone Product Information
cDNA Size:597
cDNA Description:ORF Clone of Mus musculus peroxiredoxin 2 DNA.
Gene Synonym:TR, PRP, TPx, TSA, TDX1, NkefB, PrxII, TPx-B, Tdpx1, Torin, Band-8, AL022839
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to the ahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains one thioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2.

The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items