Quick Order

Mouse P4HB / DSI Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
P4HBcDNA Clone Product Information
cDNA Size:1530
cDNA Description:ORF Clone of Mus musculus prolyl 4-hydroxylase, beta polypeptide DNA.
Gene Synonym:PDI, Thbp, ERp59, P4hb
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Mouse protein disulfide-isomerase, also known as Cellular thyroid hormone-binding protein, Prolyl 4-hydroxylase subunit beta, p55 and P4HB, is a peripheral membrane protein which belongs to the protein disulfide isomerase family. P4HB is highly abundant. In some cell types, it seems to be also secreted or associated with the plasma membrane, where it undergoes constant shedding and replacement from intracellular sources. P4HB localizes near CD4-enriched regions on lymphoid cell surfaces. It is identified by mass spectrometry in melanosome fractions from stage I to stage IV. P4HB reduces and may activate fusogenic properties of HIV-1 gp120 surface protein, thereby enabling HIV-1 entry into the cell. P4HB catalyzes the formation, breakage and rearrangement of disulfide bonds. At the cell surface, it seems to act as a reductase that cleaves disulfide bonds of proteins attached to the cell. P4HB may therefore cause structural modifications of exofacial proteins. Inside the cell, it seems to form/rearrange disulfide bonds of nascent proteins. At high concentrations, P4HB functions as a chaperone that inhibits aggregation of misfolded proteins. At low concentrations, it facilitates aggregation (anti-chaperone activity). P4HB may be involved with other chaperones in the structural modification of the TG precursor in hormone biogenesis. It also acts a structural subunit of various enzymes such as prolyl 4-hydroxylase and microsomal triacylglycerol transfer protein MTTP.

  • Kivirikko KI, et al., 1989, FASEB J., 3 (5): 1609-17.
  • Pihlajaniemi T, et al.,1991, J Hepatol., 13, Suppl 3: S2
  • Fenouillet E., et al., 2001, J. Infect. Dis. 183:744-752.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Barbouche R., et al., 2003, J. Biol. Chem. 278:3131-3136.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items