After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat ALDOB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ALDOBcDNA Clone Product Information
cDNA Size:1095
cDNA Description:ORF Clone of Rattus norvegicus aldolase B, fructose-bisphosphate DNA.
Gene Synonym:Aldo2, LIV10
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Cox TM. (1994) Aldolase B and fructose intolerance. FASEB J. 8(1): 62-71.
  • Malay AD, et al. (2005) Structure of the thermolabile mutant aldolase B, A149P: molecular basis of hereditary fructose intolerance. J Mol Biol. 347(1): 135-44.
  • Susan PP, et al. (2001) Starvation-induced lysosomal degradation of aldolase B requires glutamine 111 in a signal sequence for chaperone-mediated transport. J Cell Physiol. 187(1): 48-58.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items