Quick Order

Text Size:AAA

Mouse SERPINB9 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SERPINB9 cDNA Clone Product Information
Gene_bank_ref_id:NM_009256.3
RefSeq ORF Size:1125bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 9 with N terminal HA tag.
Gene Synonym:PI9, CAP3, PI-9, Spi6, CAP-3, BB283241, ovalbumin, Serpinb9
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SerpinB9, also known as Cytoplasmic antiproteinase 3, CAP-3, Peptidase inhibitor 9, SERPINB9 and PI-9, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. Serpin-B9 ( CAP-3 / PI-9 ) is the only known human intracellular inhibitor of granzyme B (GrB), the effector molecule in immunity against cytomegalovirus (CMV) and in renal allograft rejection. Serpin-B9 and SPI-6 expression in immune-privileged cells, APCs, and CTLs protects these cells against the actions of granzyme B, and when expressed in tumor cells or virally infected hepatocytes, confers resistance to killing by CTL and NK cells. Expression of increasing levels of Serpin-B9 ( CAP-3 / PI-9 ) in target cells may progressively inhibit immune surveillance by blocking NK and CTL-induced cytotoxicity through the perforin / granzyme pathway and then through the Fas / FasL pathway. Serpin-B9 ( CAP-3 / PI-9 ) is selectively up-regulated in hepatocytes in response to infiltration of the liver by NK cells that express perforin and enzymatically active granzyme B. Upregulated expression of Serpin-B9 ( CAP-3 / PI-9 ) in NSCLC cells may serve to protect them from apoptosis induced by GrB.

References
  • Rowshani,A.T. et al., 2005, J Infect Dis.192 (11): 1908-11.
  • Cunningham,T.D. et al., 2007, Cell Immunol 245 (1): 32-41.
  • Rousalova,I. et al., 2010, Int J Oncol  36 (1): 275-83.
  • Stout-Delgado,H.W. et al., 2007, J Immunol. 179 (10):6561-7.
  • Size / Price
    Catalog: MG50563-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"