Quick Order

Text Size:AAA

Mouse VIM ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse VIM cDNA Clone Product Information
NCBI RefSeq:NM_011701.4
RefSeq ORF Size:1401bp
cDNA Description:Full length Clone DNA of Mus musculus vimentin with N terminal HA tag.
Gene Synonym:MGC102095, Vim
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Vimentin is a type III intermediate filament (IF) protein found in various non-epithelial cells, especially mesenchymal cells. A vimentin monomer, has a central α-helical domain and carboxyl (tail) domains. Two monomers compose the basic subunit of vimentin assembly. Vimentin is crucial for supporting and anchoring the position of the organelles in the cytosol. Vimentin provided cells with a resilience absent from the microtubule or actin filament networks, when under mechanical stress in vivo. Therefore, in general, it is accepted that vimentin is the cytoskeletal component responsible for maintaining cell integrity. Vimentin is also responsible for stabilizing cytoskeletal interactions. It is found that vimentin control the transport of low-density lipoprotein. It has been used as a sarcoma tumor marker to identify mesenchyme.

References
  • Russell RL, et al. (2001) Uridine phosphorylase association with vimentin. Intracellular distribution and localization. J Biol Chem. 276(16):13302-7.
  • Moinova, et al. (2012) Aberrant Vimentin Methylation is Characteristic of Upper GI Pathologies. Cancer Epidemiology Biomarkers Prev. 21(4):594-600.
  • Leader M, et al. (1987) Vimentin: an evaluation of its role as a tumour marker. Histopathology. 11(1):63-72.
  • Size / Price
    Catalog: MG50433-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"