After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat GSTZ1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GSTZ1cDNA Clone Product Information
Gene_bank_ref_id:NM_001109445.1
cDNA Size:651
cDNA Description:ORF Clone of Rattus norvegicus glutathione S-transferase zeta 1 DNA.
Gene Synonym:Gstz1
Species:Rat
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

GSTZ1 gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. GSTZ1 is a bifunctional protein which has minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. GSTZ1 catalyzes the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. GSTZ1 participates in the catabolism of phenylalanine and tyrosine. Thus defects in GSTZ1 cause harsh metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia.

References
  • Tong Z. et al., 1999, Chem Res Toxicol. 11 (11): 1332-8.
  • Tong Z. et al., 1999, Biochem J. 331 (2): 371-4.
  • Ketterer B. 2001, Chem Biol Interact. 138 (1): 27-42.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"