Quick Order

Mouse BCHE Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCHEcDNA Clone Product Information
cDNA Size:1812
cDNA Description:ORF Clone of Mus musculus butyrylcholinesterase DNA.
Gene Synonym:MGC107651, C730038G20Rik, Bche
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase (BCHE) is widely distributed in the nervous system as well as blood plasma. It is constitutively similar to the neuronal acetylcholinesterase, and is a non-specific cholinesterase which hydrolyses many different choline esters. Butyrylcholinesterase (BCHE) is a glycoprotein of 4 identical subunits, that were arranged as a dimer of dimers with each dimer composed of two identical subunits joined by interchain disulfide bonds. Butyrylcholinesterase (BCHE) behaves principally similar to the true enzyme and thus can play a similar role in nerve conduction, although it participates probably only in relatively slow conductive processes and could be involved in other nervous system functions and in neurodegenerative diseases. It can hydrolyze toxic esters such as cocaine or scavenge organophosphorus pesticides and nerve agents. Purified human serum cholinesterase combines in its active surface an anionic and an esteratic site, similar to true cholinesterase. It has been demonstrated that butyrylcholinesterase (BCHE) may have a greater role in cholinergic transmission than previously surmised, making BChE inhibition an important therapeutic goal in Alzheimer's disease.

  • Lockridge O. (1988) Structure of human serum cholinesterase. Bio Essays. 9(4):125-8.
  • Mesulam M, et al. (2002) Widely Spread Butyrylcholinesterase Can Hydrolyze Acetylcholine in the Normal and Alzheimer Brain. Neurobiology of Disease. 9(1): 88-93.
  • Nicolet Y, et al. (2003) Crystal Structure of Human Butyrylcholinesterase and of Its Complexes with Substrate and Products. The Journal of Biological Chemistry. 278: 41141-7.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks