Quick Order

Mouse Desmocollin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DSC2cDNA Clone Product Information
Gene_bank_ref_id:NM_007882.3
cDNA Size:2691
cDNA Description:ORF Clone of Mus musculus desmocollin 3 DNA.
Gene Synonym:Dsc3
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. Like other desmocollins, murine DSC2 has two products, Dsc2a and Dsc2b, produced by alternative splicing of a 46 bp exon which encodes 11 COOH-terminal aa followed by an in-frame stop codon. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Mutations in DSC2 are associated with arrhythmogenic right ventricular dysplasia-11. DSC2 is Involved in the interaction of plaque proteins and intermediate filaments mediating cell-cell adhesion. DSC2 may contribute to epidermal cell positioning by mediating differential adhesiveness between cells that express different isoforms.

References
  • Nuber UA, et al. (1995) The widespread human desmocollin Dsc2 and tissue-specific patterns of synthesis of various desmocollin subtypes. Eur J Cell Biol. 66 (1): 69-74.
  • Marsden MD, et al. (1997) Cloning and transcriptional analysis of the promoter of the human type 2 desmocollin gene (DSC2). Gene. 186 (2): 237-47.
  • Greenwood MD, et al. (1997) Exon-intron organization of the human type 2 desmocollin gene (DSC2): desmocollin gene structure is closer to "classical" cadherins than to desmogleins. Genomics. 44 (3): 330-5.
  • Size / Price
    Catalog:MG50401-NY
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"