Quick Order

Mouse THSD1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
THSD1cDNA Clone Product Information
cDNA Size:2556
cDNA Description:ORF Clone of Mus musculus thrombospondin, type I , domain 1 DNA.
Gene Synonym:Tmtsp, AW121720, 4833423O18Rik, Thsd1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Thrombospondin type-1 domain-containing protein 1, also known as transmembrane molecule with thrombospondin module, THSD1 and TMTSP, is a single-pass type I membrane protein which contains one TSP type-1 domain. THSD1 is a multi-domain, multi-functional glycoprotein synthesized by many cells. Matricellular THSD1 modulates cell adhesion and proliferation. It is involved in angiogenesis, inflammation, wound healing and cancer. In vitro, nanomolar concentrations of Thrombospondin-1 are required to alter endothelial and vascular smooth muscle cell adhesion, proliferation, motility, and survival. As a major platelet protein, for a long time it was postulated to control hemostasis via platelet aggregate stabilization. THSD1 is a potent angiogenesis inhibitor, and down-regulation of THSD1 has been suggested to alter tumor growth by modulating angiogenesis in a variety of tumor types.

  • Lawler J. (2002) Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. J Cell Mol Med. 6(1): 1-12.
  • Ren B, et al. (2006) Regulation of tumor angiogenesis by thrombospondin-1. Biochim Biophys Acta. 1765(2): 178-88.
  • Mirochnik Y, et al. (2008) Thrombospondin and apoptosis: molecular mechanisms and use for design of complementation treatments. Curr Drug Targets. 9(10): 851-62.
  • Bonnefoy A, et al. (2008) The evolving role of thrombospondin-1 in hemostasis and vascular biology. Cell Mol Life Sci. 65(5): 713-27.
  • Isenberg JS, et al. (2008) Thrombospondin-1: a physiological regulator of nitric oxide signaling. Cell Mol Life Sci. 65(5): 728-42.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items