After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPB1cDNA Clone Product Information
Gene_bank_ref_id:NM_029706.1
cDNA Size:1248
cDNA Description:ORF Clone of Mus musculus carboxypeptidase B1 (tissue) DNA.
Gene Synonym:AI504870, 0910001A18Rik, 1810063F02Rik, 2210008M23Rik, Cpb1
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Human Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

References
  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Size / Price
    Catalog:MG50386-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"