After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SERPINB6A ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SERPINB6 cDNA Clone Product Information
Gene_bank_ref_id:NM_009254.3
RefSeq ORF Size:1137bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6a with N terminal HA tag.
Gene Synonym:Spi3, AI876477, Serpinb6, ovalbumin, 4930482L21Rik, D330015H01Rik, Serpinb6a
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SerpinB6, also known as Cytoplasmic antiproteinase, Peptidase inhibitor 6, Placental thrombin inhibitor, SERPINB6 and PI-6, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB6 / PI-6 is an inhibitor of cathepsin G, kallikrein-8 and thrombin. It may play an important role in the inner ear in the protection against leakage of lysosomal content during stress and loss of this protection results in cell death and sensorineural hearing loss. SerpinB6 / PI-6 is expressed in keratinocytes (at protein level). It is also found in placenta, cardiac muscle, lung, liver, kidney and pancreas. SerpinB6 / PI-6 is expressed in the inner ear hair cells. It expressed abundantly by normal mast cells in different tissues and by mast cells in mastocytoma lesions. SerpinB6 / PI-6 may be involved in the regulation of serine proteinases present in the brain or extravasated from the blood. Defects in SerpinB6 are the cause of deafness autosomal recessive type 91 which is a form of non-syndromic deafness characterized by progressive and age-dependent sensorineural hearing loss. Vestibular function is normal.

References
  • Morgenstern KA. et al.,1994, Biochemistry. 33: 3432-41.
  • Strik MC. et al., 2004, Blood. 103: 2710-7.
  • Scott FL. et al., 2007, J Biochem. 142: 435-42.
  • Burkard TR. et al., 2011, BMC Syst Biol. 5:17.
  • Size / Price
    Catalog: MG50374-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"