After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Angiopoietin-like4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ANGPTL4cDNA Clone Product Information
cDNA Size:1233
cDNA Description:ORF Clone of Mus musculus angiopoietin-like 4 DNA.
Gene Synonym:Arp4, Bk89, Fiaf, Ng27, Pgar, Hfarp, Pgarg, Pp1158, Angptl4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Angiopoietin/Tie Related Products

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items