After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CTSA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTSAcDNA Clone Product Information
Gene_bank_ref_id:NM_001038492.1
cDNA Size:1425
cDNA Description:ORF Clone of Mus musculus cathepsin A DNA.
Gene Synonym:PPCA, Ppgb, AU019505, Ctsa
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Lysosomal carboxypeptidase, cathepsin A (protective protein, CathA), is a component of the lysosomal multienzyme complex along with beta-galactosidase (GAL) and sialidase Neu1, where it activates Neu1 and protects GAL and Neu1 against the rapid proteolytic degradation. Cathepsin A is a multicatalytic enzyme with deamidase and esterase in addition to carboxypeptidase activities. It was recently identified in human platelets as deamidase. In vitro, it hydrolyzes a variety of bioactive peptide hormones including tachykinins, suggesting that extralysosomal cathepsin A plays a role in regulation of bioactive peptide functions. It is a member of the alpha/beta hydrolase fold family and has been suggested to share a common ancestral relationship with other alpha/beta hydrolase fold enzymes, such as cholinesterases. Cathepsin A defects are linked to multiple forms of Galactosialidosis with a combined secondary deficiency of beta-galactosidase and neuraminidase. Cathepsin A is a key molecule in the onset of galactosialidosis and also highlight the therapeutic acts in vivo as an endothelin-1-inactivating enzyme and strongly confirm a crucial role of this enzyme in effective elastic fiber formation.

References
  • Hiraiwa M. (1999) Cathepsin A/protective protein: an unusual lysosomal multifunctional protein. Cell Mol Life Sci. 56(11-12): 894-907.
  • Yoshida T, et al. (2006) Comparative analysis of binding energy of chymostatin with human cathepsin A and its homologous proteins by molecular orbital calculation. J Chem Inf Model. 46(5): 2093-103.
  • Seyrantepe V, et al. (2008) Enzymatic activity of lysosomal carboxypeptidase (cathepsin) A is required for proper elastic fiber formation and inactivation of endothelin-1. Circulation. 117(15): 1973-81.
  • Size / Price
    Catalog:MG50348-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"