Quick Order

Text Size:AAA

Mouse HAVCR1 / TIM1 / TIMD1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAVCR1cDNA Clone Product Information
Gene_bank_ref_id:NM_134248.1
cDNA Size:918
cDNA Description:ORF Clone of Mus musculus hepatitis A virus cellular receptor 1 DNA.
Gene Synonym:Tim1, TIM-1, Timd1, AI503787, Havcr1
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Human HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.

References
  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.
  • Size / Price
    Catalog:MG50321-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"