After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SERPINA7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA7cDNA Clone Product Information
cDNA Size:1257
cDNA Description:ORF Clone of Mus musculus serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 DNA.
Gene Synonym:TBG, C730040N12Rik, Serpina7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Thyroxine-binding globulin, also known as T4-binding globulin, Serpin A7 and TBG, is a secreted protein which belongs to the serpin family. TBG is synthesized primarily in the liver as a 54 kDa protein.TBG is genomically a serpin, although it has no inhibitory function like many other members of this class of proteins. TBG binds thyroid hormone in circulation. It is one of three proteins (along with transthyretin and albumin) responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3’-triiodothyronine (T3) in the bloodstream. Of these three proteins, TBG has the highest affinity for T4 and T3, but is present in the lowest concentration. Despite its low concentration, TBG carries the majority of T4 in serum. Due to the very low serum concentration of T4 and T3, TBG is rarely more than 25% saturated with its ligand. Unlike transthyretin and albumin, TBG has a single binding site for T4/T3. TBG tests are sometimes used in finding the reason for elevated or diminished levels of thyroid hormone.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks