Quick Order

Text Size:AAA

Mouse PPIA ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PPIA cDNA Clone Product Information
Gene_bank_ref_id:NM_008907.1
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Mus musculus peptidylprolyl isomerase A with N terminal HA tag.
Gene Synonym:Cphn, CypA, CyP-18, 2700098C05, Ppia
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse peptidyl-prolyl cis-trans isomerase A, also known as PPIase A, Rotamase A, Cyclophilin A, Cyclosporin A-binding protein, PPIA and CYPA, is a cytoplasm protein which belongs to the cyclophilin-type PPIase family and PPIase A subfamily. Cyclophilins (CyPs) are a family of proteins found in organisms ranging from prokaryotes to humans. These molecules exhibit peptidyl-prolyl isomerase activity, suggesting that they influence the conformation of proteins in cells. PPIA / Cyclophilin A accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIA / Cyclophilin A is secreted by vascular smooth muscle cells in response to inflammatory stimuli, and could thus contribute to atherosclerosis. It is not essential for mammalian cell viability. PPIA / Cyclophilin A can interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions.

Size / Price
Catalog: MG50296-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"