After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse RAMP3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse RAMP3 cDNA Clone Product Information
Gene_bank_ref_id:NM_019511.3
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Mus musculus receptor (calcitonin) activity modifying protein 3 with C terminal HA tag.
Gene Synonym:AI850306
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

RAMP3 belongs to the RAMP family. Members of this family are single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs have a wide biological distribution; high concentrations are found in the brain, lung, liver, heart and spleen with lower expression levels present in the testes, gastrointestinal tract and thyroid. RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. They are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of RAMP3 protein, CRLR functions as an adrenomedullin receptor.

References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Scherer SW, et al. (2003) Human chromosome 7: DNA sequence and biology. Science. 300(5620):767-72.
  • Kuwasako K, et al. (2004) Characterization of the human calcitonin gene-related peptide receptor subtypes associated with receptor activity-modifying proteins. Mol Pharmacol. 65(1):207-13.
  • Size / Price
    Catalog: MG51528-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"