After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A10cDNA Clone Product Information
cDNA Size:294
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A10 (calpactin) DNA.
Gene Synonym:42C, p10, p11, CAL12, CLP11, Cal1l, AA409961, AL024248, S100a10
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  
Protein S100-A10, also known as Calpactin I light chain, Cellular ligand of annexin II, S100 calcium-binding protein A10, p10 protein, p11, ANX2LG and S100A10, is a member of the S100 family of small, dimeric EF hand-type Ca(2+)-binding proteins that generally modulate cellular target proteins in response to intracellular Ca(2+) signals. In contrast to all other S100 proteins, S100A10 is Ca(2+) insensitive because of amino acid replacements in its Ca(2+)-binding loops that lock the protein in a permanently active state. S100A10 forms a heterotetramer with annexin IIH and promotes carcinoma invasion and metastasis by plasminogen activation. S100A10 and annexin II contribute to the aggressive characteristics of anaplastic carcinoma, while playing a constitutive role in papillary carcinoma. S100A10 induces the dimerization of ANXA2 / p36, it may function as a regulator of protein phosphorylation in that the ANXA2 monomer is the preferred target of tyrosine-specific kinase. S100A10 functions as a linker tethering certain transmembrane proteins to annexin A2 thereby assisting their traffic to the plasma membrane and/or their firm anchorage at certain membrane sites.

  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Ito,Y. et al., 2007, Anticancer Res. 27 (4C):2679-83.
  • Svenningsson,P. et al., 2007, Curr Opin Pharmacol  7 (1):27-32.
  • Rescher,U. et al., 2008, Pflugers Arch. 455 (4):575-82.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items